UCSC Genome Browser: Non-standard Join Certificates: Build 34

JavaScript is disabled in your web browser

You must have JavaScript enabled in your web browser to use the Genome Browser

Non-standard Join Certificates: Human Build 34 (July 2003)

Accession 1	Accession 2	Spanner	Variation	Variation Evidence	Comment	Evaluation	Remark	Contact
AL606514	AL627107		sine	none	Alu. Deletions in alu repeats in both clones disrupting join. There is one BAC End which supports the join RPCI-456B9. Also looking at the actual size of the overlaps between AL627107 and AL606514, the total overlap in unsubmitted sequence is 86688bp. AL627107 also actualy overlaps AL139326 (the clone after AL606514 in the TPF) by about 50Kb, but as AL606514 was finished first, it remained in the TPF.	pass	Would be better to have BAC, fosmid end support or other, but extensive overlap from unsubmitted sequence is a good proxy. It seems that the clone AL606514 may be unnecessary to have in TPF if AL527107 overlaps AL139326.	[email protected]
AP002529	AP002530	AL359174			Blunt end join submitted by JST spanned by AL359174.14 and 10 BAC, 4 fosmid end pairs.	pass		[email protected]
AP002530	AP002531	AL355532			Blunt end join submitted by JST spanned by AL355532.10 and 7 BAC, 3 fosmid end pairs.	pass		[email protected]
AL008729	AL391385		sslp	Not experimental	100bp overlap. Join supported by 4 BACs and 4 Fosmids. Half dovetail; misses other side by 19bp as a result of a 9bp polyA indel. AL391385.8 has (A)31; AL008729.1 has (A)22.	pass		[email protected]
AL034346	AL499606		other	Not experimental	2000bp overlap. Variations clustered in the tandem repeat of the overlap. Half dovetail; misses other side by 145bp. 14 copies of 34bp repeat in AL499606.18; 25 copies of 34bp repeat in AL034346.31. Join supported by 10 BAC and 1 fosmid end pairs.	return	requires additional support eg. PCR	[email protected]
AL096678	AL159174		sslp	Not experimental	2082bp overlap. 464bp deletion in AL096678.8 which includes (CA)n and (TA)n. Join supported by 11 BACs and 6 fosmids	pass		[email protected]
AL109940	AL442124		other	Not experimental	100bp overlap +/+ orientation. 51bp tandem repeat causing assembly trouble. 20 copies in AL109940 and 40 copies in AL442124. Join supported by 5 BAC and 8 fosmid end pairs.	return	requires additional support eg pcr.	[email protected]
AL357058	AP002528				Preferential use of Sanger sequence (AL357058) to JST sequence (AP002528.1)	pass	This is a unique situation, with one clone contained entirely within another. This is not really a bad join, but a substitution of part of a project with another. Pass, as discussed with GS and AJM.	[email protected]
AL445250	AL591624		sslp	Not experimental	110369bp overlap. 474 bp deletion in AL445250: 180bp (TATAA)n Simple_repeat, 200bp (TTATA)n Simple_repeat and 61bp AT_rich Low_complexity repeat. Join supported by 4 pairs of BAC ends and 2 pairs of fosmid ends	pass		[email protected]
AL591046	AL591073		other	Not experimental	101450bp overlap. Join supported by 3 pairs of BAC ends.	return	Extensive overlap, but missing information. Please describe variation	[email protected]
AL591480	AL596449		other	Not experimental	32827bp overlap. 10377bp deletion in AL596449.4. Join supported by 12 BAC and 6 fosmid end pairs.	return	requires additional support eg pcr.	[email protected]
AL133255	AL591044	AL596216			Overlap of 6bp at GAATTC cloning site. Join supported by PCR product sequence AL596216.1 and 2 pairs of BAC and fosmid ends.	pass		[email protected]
AB000878	AC006046				This is the boundary between Inoko MHC class I and the class III here represented by Geraghty sequence, overlap is 18554bp	pass	probably OK, given region and extensive overlap. More BAC/fosmid end support might be useful. Fairly unique situation.	[email protected]
AB000878	AB000879	AP000506			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 3 fosmid end pairs.	pass		[email protected]
AB000879	AB000880	AP000507			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 2 BAC, 1 fosmid end pairs.	pass		[email protected]
AB014077	AB023052	AP000513			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 8 fosmid end pairs.	pass		[email protected]
AB014077	AB014078	AP000514			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 5 fosmid end pairs.	pass		[email protected]
AB014078	AB014079	AP000514			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs.	pass		[email protected]
AB014079	AB014080	AP000514			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 2 fosmid end pairs.	pass		[email protected]
AB014080	AB014081	AP000514			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs.	pass		[email protected]
AB014081	AB014082	AP000514			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 7 BAC, 6 fosmid end pairs.	pass		[email protected]
AB014082	AB014083	AP000515			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 7 fosmid end pairs.	pass		[email protected]
AB014083	AB014084	AP000515			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 4 fosmid end pairs.	pass		[email protected]
AB014084	AB014085	AP000515			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 5 fosmid end pairs.	pass		[email protected]
AB014085	AB014086	AP000516			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 7 fosmid end pairs.	pass		[email protected]
AB014086	AB014087	AP000516			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 7 BAC, 8 fosmid end pairs.	pass		[email protected]
AB014087	AB014088	AP000516			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs.	pass		[email protected]
AB014088	AB023053	AP000516			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 9 BAC, 5 fosmid end pairs.	pass		[email protected]
AB023048	AB023060	AP000510			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 8 fosmid end pairs.	pass		[email protected]
AB023048	AB023050	AP000511			MHC class I. Overlap of 6bp restriction site (AAGCTT). Join supported by 3 BAC, 9 fosmid end pairs.	pass		[email protected]
AB023049	AB023051	AP000512			MHC class I. Overlap of 6bp restriction site (AAGCTT). Join supported by 5 BAC, 3 fosmid end pairs.	pass		[email protected]
AB023049	AB023052	AP000513			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 4 BAC, 5 fosmid end pairs.	pass		[email protected]
AB023050	AB023051	AP000512			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 3 BAC, 3 fosmid end pairs.	pass		[email protected]
AB023053	AB023055	AP000517			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 8 BAC, 4 fosmid end pairs.	pass		[email protected]
AB023056	AB023057	AP000520			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 5 BAC, 5 fosmid end pairs.	pass		[email protected]
AB023059	D84394	AP000509			MHC class I. Overlap of 6bp restriction site (GAATTC). Join supported by 5 BAC, 2 fosmid end pairs.	pass		[email protected]
AB023059	AB023060	AP000509			MHC class I. Overlap of 4bp restriction site (GATC). Join supported by 3 BAC, 2 fosmid end pairs.	pass		[email protected]
AC003098	AC015937		sslp	Blast2 and RepeatMasker	AC003098 contains 22bp more of sslp at bp 93315. PAC/CIT. 2000 bp total overlap. 2 supporting fosmids	pass		[email protected]
AC003976	AC069363		sslp	Blast2 and RepeatMasker	AC003976 has a 172 bp deletion in a (GAAA)n repeat. RP11/CIT libraries 58000 bp overlap. 11 supporting fosmids.	pass	11 fosmid ends - is this overrepresentation? Please comment.	[email protected]
AB020862	AB020863	AC079187			6 supporting BACs, 2 supporting fosmids.	pass		[email protected]
AC004707	AC015909		sine	Blast2 and RepeatMasker	AC015909 contains 384 bp inserted region containing Alu and simple repeat (TGAA)n. RP11/PAC. Total 51000 bp overlap 1 supporting Bac; 11 supporting fosmids.	pass	Concern re over-representation of 11 pairs fosmid ends. Please comment.	[email protected]
AC004585	AC018629		sine	Blast2 and RepeatMasker	AC004585 contains 571 bp inserted region containing Alu, FLAM_C, and simple repeat (TTCC)n. RP11/PAC Total 5500 bp overlap 3 supporting Bacs; 2 supporting fosmids.	pass	multiple variations-probably better to confirm polymorphism	[email protected]
AC006050	AC090685		sslp	Blast2 and RepeatMasker	AC006050 missing 312 bases within a (TATATG)n repeat. RP11/PAC 81000 bp total overlap,6 Bacs; 5 supporting fosmids.	pass		[email protected]
AC006251	AC015922		sslp	Blast2 and RepeatMasker	AC006251 has a 4217 bp deletion(126811..131028). CIT/PAC 38000 bp total overlap. 5 Bacs; 4 fosmids support join.	pass		[email protected]
AC007632	AC023394		sslp	repeatmasker and human analysis	TA simple repeat region is ~250bp longer in AC023394; join is supported by high % identity across the overlap and 1 fosmid and 6 BACs which link across the join	pass		[email protected]
AC009277	AC068506		other	sequence alignment; to be tested	duplication of 289bp in AC009277; perfect repeat; join is supported by high % identity across the overlap and 5 pairs of fosmid end seq and 6 pairs of BAC end seq which link across the join	return	Requires additional support, eg PCR	[email protected]
AC009285	AC087224		sslp		ID is 99.53 (below threshold of 99.60) in 28kb ol. Areas of low ID are accounted for as SSLPs in simple repeat areas. Join supported by 1 BAC and 7 fosmids.	pass		[email protected]
AC009455	AC079062		sslp	repeat masker, sequence alignment	TA simple repeat region is ~200bp longer in AC079062; join supported by 4 BACs which link across join. Total overlap 41kb.	pass		[email protected]
AC011120	AC080037		sine	Blast2 and RepeatMasker	AC011120 contains inserted AluJo not present in AC080037. Total 142000 bp overlap 6 supporting Bacs; 19 supporting fosmids.	return	is 19 fosmid-ends overrepresentation? Please comment.	[email protected]
AC011825	AC015563		other	to be tested	189bp deletion in AC015563; join is supported by high % identity across the overlap and 5 pairs fosmid end seq and 4 pairs of BAC end seq which link across the join	return	Requires additional support, eg PCR	[email protected]
AC012213	AC069351		sine	Global Sequence Alignment and RepeatMasker	40 kb overlap. Break in alignment is caused by 310 bp AluY insertion in AC069351. 3 supporting BACs, 11 supporting fosmids.	pass		[email protected]
AC012238	AC023926		line	Global Sequence Alignment and RepeatMasker	33 kb overlap. Break in alignment is a result of 299 bp L1PA4 insertion in AC023926. 3 supporting BACs, 2 supporting fosmids.	pass		[email protected]
AC013290	AC022601		sine	repeatmasker	break in alignment caused by ~286bp insertion of AluY SINE/Alu element in AC022601; join is supported by high % identity across the overlap and 1 pair of fosmid end seq and 6 pairs of BAC end seq which link across the join	pass		[email protected]
AC015691	AC109341		sslp	Global Sequence Alignment, RepeatMasker	61kb overlap, MIR and AT-rich, supported by 6 pairs of BAC ends, 4 pairs of fosmid ends.	pass		[email protected]
AC015700	AC100763		line	RepeatMasker, Global Sequence Alignment	105kb overlap, L1PA3 in AC015700`s 75649- 75828, supported by 2 pairs of BAC ends, 4 pairs of fosmid ends	pass		[email protected]
AC015884	AC016292		sslp	Blast2 and RepeatMasker	AC015884 contains ~6 more copies of a 30bp repeat 41662 bp total overlap 3 supporting bacs, 7 supporting fosmids	pass		[email protected]
AC015884	AC036164		sslp	Blast2 and RepeatMasker	AC015884 contains 1029 bp inserted region containing ~16 more copies of a 65 bp repeat. Found at bp 316-1344 (GGGGGGGGCTGGAGTCAGAGAGACCAAGGTTGGAACCCGGC AGGTACCACGGACGGTCACACTGT) AC015884 contains 388 bp inserted region containing same repeat element as above. Bp 1870-2257 9300 bp total overlap 3 supporting bacs, 4 supporting fosmids.	pass		[email protected]
AC015921	AC097370		other	Blast2 and RepeatMasker	AC015921 contains inserted region of 467 bp. 14790 total overlap. 1 supporting Bac, 4 supporting fosmids	return	requires additional support (eg pcr).	[email protected]
AC016888	AC064805		sslp	Blast2 and RepeatMasker	AC016888 contains 120 bp deletion in MER4A element. 49000 bp total overlap, 3 supporting Bacs; 4 supporting fosmids.	pass		[email protected]
AC018943	AC108137		other	BLAST2, Global Sequence Alignment, RepeatMasker	AC018943 contains 193 bp insertion that is not present in AC108137. Total overlap is 23 Kb, 5 supporting BACs, 9 supporting fosmids	return	Probably OK, but requires additional confirmation of insertion polymorphism	[email protected]
AC021553	AC100825		line	BLAST2, Global Sequence Alignment, RepeatMasker	AC021553 contains 231 bp of a LINE/L2 element not present in AC100825. Total overlap is 26Kb, 1 supporting BAC, 1 supporting fosmid.	pass		[email protected]
AC021594	AC068473		other	human analysis and sequence alignment	Insertion of a ~180bp of a 38bp repetive element in AC068473. Join supported by 3 BACs and 10 fosmids. Total overlap 48kb.	pass	is 12 pairs fosmid-ends overrepresentation? Comment please.	[email protected]
AC021760	AC040926		sslp	BLAST2, Global Sequence Alignment	overlap of 10kb. SSLP 121bp longer in AC021760. 12 supporting BACs.	pass	is 12 pairs BAC-ends overrepresentation?	[email protected]
AC022558	AC044907		line	BLAST2, Global Sequence Alignment, RepeatMasker	AC044907 contains 6,031 bp of a LINE/L1HS element not present in AC022558. Total overlap is 49Kb, 5 supporting BACs, 7 supporting fosmids.	pass		[email protected]
AC022596	AC098850		sine	Blast2 and RepeatMasker	AC022596 contains inserted Alu not present in AC098850. Total 120000 bp overlap, 4 supporting Bacs; 18 supporting fosmids.	return	is 18 pairs fosmid-ends overrepresentation? Please comment.	[email protected]
AC024474	AC061965		sslp	BLAST2, Global Sequence Alignment, RepeatMasker	AC061965 contains 559 bp of C-rich, (CACCT)n, (CACCC)n elements not present in AC024474. Total overlap is 9Kb, 4 supporting BACs, 3 supporting fosmids	pass		[email protected]
AC024610	AC078907		sslp	Blast2 and RepeatMasker	AC078907 missing 258 bases within a (TAG)n repeat. 54000 bp total overlap 5 supporting Bacs; 20 supporting fosmids.	return	is 20 fosmid-ends overrepresentation? Please comment.	[email protected]
AC025519	AC053479		sslp	BLAST2 and RepeatMasker	94 kb overlap. Break in alignment is caused by a 286 bp (TA)n insertion in AC053479. 2 supporting BACs, 3 supporting fosmids.	pass		[email protected]
AC025521	AC100832		sine	Blast2 and RepeatMasker	AC100832 contains 217 bp inserted region containing Alu. 33000 bp total overlap 3 supporting BACS and 1 supporting fosmid.	pass		[email protected]
AC025787	AC109635		sslp	Global Sequence Alignment, RepeatMasker	116kb overlap, (TA)n (TAA)n SSLP, supported by 3 pairs of BAC ends, 4 pairs of fosmid ends	pass		[email protected]
AC026636	AC104938		other	BLAST2, Global Sequence Alignment, RepeatMasker	There are 2 ins/del in this overlap: AC026636 contains 360 bp of a LINE/L2 element that is not present in AC104938, and AC104938 contains 133 bp of a SINE/Alu/AluJo element that is not present in AC026636. Total overlap is 36 Kb, 4 supporting BACs, 7 supporting fosmids. AC026636 is from the RP11 library, AC104938 is from the CTD library	pass		[email protected]
AC026991	AC087367		sslp	BLAST2, Global Sequence Alignment	overlap of 59kb. SSLP 311bp longer in AC026991. 3 supporting BACs, 5 supporting fosmids.	pass		[email protected]
AC036164	AC087392		sslp	Blast2 and RepeatMasker	AC087392 contains 354bp inserted region at bp 16581. AC036164 contains 330 bp more of a (GGTTG)n repeat at bp 68475. 30896 bp total overlap. 7 supporting bacs, 4 supporting fosmids.	pass		[email protected]
AC036196	AC103858		other	BLAST2, Global Sequence Alignment, RepeatMasker	AC103858 has 995 bp region (containing L2 and MER elements) flanked by two AluSx elements, while in the analogous region of AC036196 there is only one AluSx element and not the L2 and MER elements. Total overlap is 47Kb, 7 supporting BACs, 2 supporting fosmids.	return	multiple complex `other` requires confirmation of polymorphism eg by PCR	[email protected]
AC044814	AC107934		other	BLAST2, Global Sequence Alignment	overlap of 147kb. 173bp tigger2 insertion in AC107934. 5 supporting BACs, 2 supporting fosmids.	pass		[email protected]
AC055854	AC105046		sslp	BLAST2, Global Sequence Alignment	overlap of 33kb. SSLP 325bp longer in AC055854. 3 supporting BACs, 6 supporting fosmids.	pass		[email protected]
AC083845	AC103760		line	Global Sequence Alignment and RepeatMasker	43 kb overlap. Break in alignment is caused by a 28 bp (T)n and 109 bp L1HS insertion in AC083845. 1 supporting fosmid.	pass		[email protected]
AC083973	AC107885		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 56kb. Two breaks in alignment caused by 311bp SINE insertion in AC083973 and 479bp insertion of SINE LINE SINE in AC083973. 4 supporting BACs, 5 supportings fosmids.	pass	Probably OK, but multiple problems may warrant confirmation of haplotypes	[email protected]
AC084125	AF186192		other	Global Sequence Alignment and RepeatMasker	17 kb overlap. Two breaks in the alignment. One is caused by a low complexity GC-rich region which is 967 bp longer in AF186192. The other is caused by multiple Alu and AluJ/FRAM repeats (767 bp) in AC084125 while the corresponding region in AF186192 has multiple AluSg/x repeats (567 bp). 1 supporting BAC, 4 supporting fosmids. CTD clone and RP4 clone libraries	return	This multiple variation is actually quite interesting, but should be confirmed as a polymorphism by pcr.	[email protected]
AC087269	AC090567		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 32kb. 166bp LTR12C insertion in AC090567. 3 supporting BACs, 6 supporting fosmids.	pass		[email protected]
AC087399	AC087675		other	sequence alignment and human analysis	Insertion of ~500bp made of an 80bp repetetive element in AC087399. Insertion of ~240bp in AC087675. Join supported by 4 BACs and 3 fosmids. Total overlap 97kb.	return	multiple `other` (insertions) requires additional support (eg pcr)	[email protected]
AC087516	AC103988		sine	BLAST2, Global Sequence Alignment, RepeatMasker	AC103988 contains 313 bp of AluSx and AluY elements not present in AC087516. Total overlap is 57Kb, 10 supporting BACs, 5 supporting fosmids.	pass		[email protected]
AC087675	AC109314		sslp	repeat masker	AT-rich region. Join supported by 2 BACs and 1 fosmid. Total overlap 42kb.	pass		[email protected]
AC087691	AC107993		other	Blast2 and RepeatMasker	AC087691 contains 240 bp inserted region containing MSR1 satellite elements 37000 bp total overlap 6 supporting Bacs; 2 supporting fosmids.	pass		[email protected]
AC090354	AC090396		other	sequence alignment and human analysis	There is a ~500bp segment of sequence that is repeated once more in AC090396 than in AC090354. 6 BACs and 5 fosmids confirm join. Total overlap 116kb.	pass		[email protected]
AC090377	AC107990		sine	sequence alignment	break in alignment caused by 946bp insertion in AC107990 (contains a AluJb and AluY), Overlap confirmed with AP001549 which does not contain the insertion. 5 pairs of fosmid end seq and 3 pairs of BAC end seq link across this join)	pass		[email protected]
AC090592	AC100770		other	RepeatMasker, Global Sequence Alignment	125kb overlap, LTR33 repeated in AC090592, supported by 2 pairs of fosmid ends. Draft AC025235 supports join.	pass		[email protected]
AC090639	AC107925		sslp	Global Sequence Alignment	61kb overlap, (AT)n, AT-rich, supported by 4 pairs of BAC ends, 2 pairs of fosmid ends	pass		[email protected]
AC090691	AC100797		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 57kb. Break in alignment caused by imperfect 28mer repeat ("CCCCTCGGCGAGGACAGAGGCGCGGCGG ") that is 770bps larger in AC090691. 2 supporting BACs, 6 supporting fosmids.	pass		[email protected]
AC090796	AC091561		sslp	BLAST2, Global Sequence Alignment	overlap of 111kb. SSLP 317bp longer in AC090796. 3 supporting BACs, 2 supporting fosmids.	pass		[email protected]
AC090970	AC090971		other	repeat masker	SINE/other. broken overlap caused inserted region of three Charlie1 elements with two intervening AluSx elements (Charlie1- AluSx- Charlie1- AluSx- Charlie1), 1,037 bp total, in AC090970; join is supported by high % identity across the 117 kb overlap and 12 fosmids which link across the join.	return	is 12 pairs fosmid-ends overrepresentation? Please comment.	[email protected]
AC091010	AP003480		sslp	BLAST2 and RepeatMasker	58 kb overlap. Break in alignment is caused by a 342 bp (TAAA)n insertion in AC091010. 7 supporting BACs, 3 supporting fosmids.	pass		[email protected]
AC091170	AC100778		sine	repeatmasker	~300bp AluYa5 element present in AC100778. TA simple repeat region is ~300bp longer in AC100778. join is supported by high % identity across the overlap, 1 BAC & 5 fosmids. Total overlap 79kb.	pass		[email protected]
AC079073	AC104042		sine	RepeatMasker, Global Sequence Alignment	44kb overlap, AluSx insertion in AC104042, supported by 7 pairs of BAC ends, 5 pairs of fosmid ends	pass		[email protected]
AC079200	AC112673		line	BLAST2, Global Sequence Alignment	overlap of 18kb. 354bp LINE insertion in AC112673. 6 supporting BACs, 6 supporting fosmids.	pass		[email protected]
AC102802	AC103952		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 41kb. Two breaks in alignment caused by 4110bp insertion in AC103952 and 321bp insertion in AC102802 containing SINE. 2 supporting BACs, 1 supporting fosmid.	return	multiple, insertion probably requires additional confirmation	[email protected]
AC103834	AC103877		sine	BLAST2, Global Sequence Alignment	overlap of 38kb. 283bp Alu insertion in AC103834. 6 supporting BACs, 3 supporting fosmids.	pass		[email protected]
AC104038	AC107881		sslp	Global Sequence Alignment, RepeatMasker	95kb overlap, SSLP (CACCC)n (CCA)n, supported by 8 pairs of BAC ends, 12 pairs of fosmid ends	pass	is 12 pairs fosmid-ends overrepresenataion?	[email protected]
AC104989	AC105029		sslp	BLAST2, Global Sequence Alignment	overlap of 32kb. SSLP 294bp longer in AC104989. 3 supporting fosmids.	pass		[email protected]
AC105110	AC108452		other	sequence alignment	inversion of ~2240bp in the overlap region; join is supported by high % identity across the overlap 10 pairs of fosmid end seq and 2 pairs of BAC end seq which link across the join	return	Requires additional support, eg PCR	[email protected]
AC105142	AC107877		other	BLAST2	18 kb overlap. Break in alignment is caused by a 249 bp insertion in AC107877. 8 supporting BACs and another supporting finished accession (AP004710).	return	Insertion requires futher support as being polymorphic	[email protected]
AC110288	AF067845		other	Global Sequence Alignment and RepeatMasker	other and SSLP. 26 kb overlap. Six breaks in the alignment. 1. Low complexity region is 616 bp longer in AF067845. 2.(GT)n repeat is 677 bp longer in AF067845. 3. AC110288 has an extra copy of a GGAGGAGAAACGTGGCAGGCGTGAACAGACACCACGTGAGAC repeat. 4. AF067845 has an extra copy of a CACGTGAGACAGGGAGGAGAAACGTGGCAGGCGTGAACAGA repeat. 5. AF067845 has an extra copy of a ATTTTCTGTGAGTTCCCGAGCTCTGCTCCACACCTGGGACCG GACTCGGAATTTTCTGTGAGTTCCCGAGCTCTGCTCCATACC TGGGACCGGACTCAGC repeat. 6. poly A region is 11 bp longer in AC110288. 1 supporting BAC test seq, 1 supporting draft (AC141072), 5 supporting fosmids. CTD clone versus P1 clone.	return	Multiple `other`, requires additional support eg. PCR	[email protected]
AC019257	AC100810		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 20kb Breaks in alignment caused by imperfect 23mer repeat larger in AC100810 by 389bps "CCCCATCTGGTTAGAACGCTGCA", imperfect 37mer repeat larger in AC100810 by 480bps "CCCCAGGGGACAGCATGACAGATCCTCTCGCCGCACA", 5 supporting BACs 3 supporting fosmids	return	This probably needs additional support as to polymorphism.	[email protected]
AC018665	AC040980		sslp	Blast2 and RepeatMasker	AC018665 contains 43 bases more of AT repeat at 124167. 69000 bp total overlap	pass		[email protected]
AC055866	AC135721		sine	Blast2 and RepeatMasker	AC135721 contains 611 bp inserted region containing Alu. RP11/CIT libraries. 10000 bp total overlap, 4 supporting fosmids.	pass		[email protected]
AC073446	AC100756		sslp	repeat masker	broken overlap caused by CT_rich low complexity region (350 bp) in AC073446; join is supported by high % identity across the 162 kb overlap and 8 BAC`s and 15 fosmids which link across the join.	return	is 15 pairs fosmid-ends overrepresentation? Please comment.	[email protected]
AC000377	AC124057		line	Global Sequence Alignment, RepeatMasker	49kb overlap, LINE1 insertion in AC000377, supported by 7 pairs of fosmid ends	pass		[email protected]
AC109341	AC131574		sine	Global Sequence Alignment	55kb overlap, AluSx repeats more in AC131574, supported by 6 pairs of BAC ends, 4 pairs of fosmid ends	pass		[email protected]
AC055876	AC135348		sslp	BLAST2, Global Sequence Alignment, RepeatMasker	AC135348 contains 18 bp of (A)n that is not present in AC055876. Total overlap is 5 Kb, 14 supporting BACs, 5 supporting fosmids. AC135348 is from the RP13 library, AC055876 is from the RP11 library	return	is 15 pairs of BAC-ends overrepresentation? Please comment.	[email protected]
AC139149	AC139530		sine	sequence alignment, repeat masker	Insertion of ~310bp composed of 1 AluYb8 element in AC139149. Join supported by 10 BACs & 10 fosmid spanners. Total overlap 42kb.	pass		[email protected]
AC138080	AP000079		line	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 85kb, Break in alignment caused by LINE in 396bp segment in AC138080, 1 supporting BAC 3 supporting fosmids	pass		[email protected]
AC115090	AC124789		sslp	Blast2 and RepeatMasker	AC124789 contains 339 bp more of a (TA)n repeat at bp 21617 27000 bp total overlap	pass		[email protected]
AC091172	AC125257		other	Blast2 and RepeatMasker	AC091172 contains 3932 bp deletion at 164383. 126000 bp total overlap. 3 supporting Bacs; 6 supporting fosmids.	return	big deletion---requires additional support of polymorphism (eg pcr)	[email protected]
AC004908	AC131281		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 94kb Break in alignment caused by a 3934bp segment in AC131281 containing SSLP, LINEs and an analogous 520bp segment in AC004908 containing a LINE	return	is 15 pairs of fosmid-ends overrepresentation? Multiple variations may require additional support eg. PCR	[email protected]
AC104389	AC129505		other	sequence alignment	778 bp deletion in AC129505, 2 pairs of fosmid end link across join	return	requires additional support eg. PCR	[email protected]
AC107971	AC130312		sslp	Sequence Alignment, RepeatMasker	60kb overlap, SSLPs in centromeric region	return	requires BAC, fosmid end support or other	[email protected]
AC021317	AC115992		sslp	Blast2 and RepeatMasker	AC021317 contains 524 bp inserted region containing ALU at bp 36310. RP11/CIT. 21385 bp total overlap. 6 supporting bacs, 7 supporting fosmids	pass		[email protected]
AC100777	AC116002		sslp	repeatmasker and human analysis	GAA simple repeat region is ~430bp longer in AC100777; join is supported by high % identity across the overlap and 5 pairs of fosmid end seq and 8 pairs of BAC end seq which link across the join	pass		[email protected]
AC100791	AC116025		sslp	Blast2 and RepeatMasker	AC100791 contains 353 bp more of (CAT)n repeat at bp 131892 RP11/CIT. 115000bp total overlap. 6 supporting bacs, 3 supporting fosmids	pass		[email protected]
AC104419	AC115485		other	BLAST2, RepeatMasker	overlap of 27kb. Break in alignment is caused by a 3.5kb insertion (containing L2, L2, LTR60, L2) in AC115485 that is flanked by AluSx. Analogous position in AC104419 has only AluSx. RP11 clone versus GS1 clone. 3 supporting BACs, 11 supporting fosmids, 1 supporting draft, AF215849.	pass		[email protected]
AC105195	AP004290		line	Global Sequence Alignment and RepeatMasker	44 kb overlap. Break in alignment is caused by a 317 bp L1MC/D insertion in AP004290. 2 supporting BACs, 2 supporting fosmids, and another supporting finished accession (AC104980).	pass		[email protected]
AP000079	AP000080	AL355484			3 supporting BACs, 1 supporting fosmid.	pass		[email protected]
AC091060	AC118757		sslp	repeatmasker and human analysis	GA-rich low complexity repeat is ~155bp longer in AC091060; join is supported by high % identity across the overlap and 5 pairs of fosmid end seq and 3 pairs of BAC end seqwhich link across the join	pass		[email protected]
AC104257	AC120041		other	Global Sequence Alignment and RepeatMasker	68 kb overlap. Two breaks in the alignment. One is caused by 1122bp L1PA4 insertion in AC104257, while the other one is caused by a 179bp (TTATA)n insertion in AC104257. 1 supporting BAC, 4 supporting fosmids. RP11 clone versus CTD clone.	pass		[email protected]
AC111170	AC111182		sslp	Blast2 and RepeatMasker	AC111170 contains 78 bp more of unresolved homopolymeric tract at 17741-17824bp 55305 bp total overlap 5 supporting bacs, 5 supporting fosmids.	pass		[email protected]
AC004612	AC123779		sine	Global Sequence Alignment and RepeatMasker	17 kb overlap. Break in alignment is caused by a 311 bp AluYa5 insertion in AC004612. 3 supporting BACs, 1 supporting fosmid.	pass		[email protected]
AC110014	AC120055		sslp	repeat masker and human analysis	TA simple repeat region is ~1kB longer in AC110014; join is supported by high % identity across the overlap and 1 pair of BAC end seq which link across the join	pass	Preferable to have additional BAC or fosmid end support	[email protected]
AC025018	AC117569		sslp	repeatmasker and human analysis	TA rich simple repeat region is ~500bp longer in AC117569; join is supported by 2 pairs of BAC end seq which link across the join	pass		[email protected]
AC110288	AC120035		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 29kb. Two breaks in alignment caused by imperfect 42mer repeat ("CAGCCATCCGTGGACTGGGGTAGACTGTGAGCGGTTAATC TC") that is 798bps larger in AC110288. Imperfect 45mer repeat ("CAGGTACCTGGATGGGTTCATTTGGGTGCATCACCTGGAG ACGTC") that is 225bps larger in AC110288. 1 supporting BAC, 2 supporting fosmids.	pass		[email protected]
AC027701	AC127034		other	Global Sequence Alignment and RepeatMasker	78 kb overlap. Break in alignment is caused by a 560 bp insertion of a combination of LTR`s and a SSLPs (LTR-LTR-SSLP-LTR) in AC027701. 2 supporting BACs, 2 supporting fosmids.	pass		[email protected]
AC104423	AC125437		sine	sequence alignment, repeat masker	Insertion of ~320bp composed of 2 Alu elements in AC125437. Join supported by 4 BACs and 6 fosmids. Total overlap 45kb.	pass		[email protected]
AC090616	AC129917		sine	Blast2 and RepeatMasker	AC129917 contains 186 bp inserted region containing Alu. contains AluSq not rpesent in AC129917, 75000 bp total overlap 3 supporting Bacs; 5 supporting fosmids.	pass		[email protected]
AC122179	AC127030		sine	repeatmasker, sequence alignment	Alu, Line insertion in AC122179	return	requires BAC, fosmid end support or other	[email protected]
AC107956	AC126389		sine	RepeatMasker, Global Sequence Alignment	23kb overlap, AluSq longer in AC126389 than AC107956, supported by 2 pairs of BAC ends, 2 pairs of fosmid ends	pass		[email protected]
AC013791	AC131971		sine	Global Sequence Alignment	19kb overlap, AluSx repeat. 2 copies in AC131971, 1 copy is AC013791, 8 fosmid ends	pass	is 12 pairs fosmid-ends overrepresentation?	[email protected]
AC108448	AC131971		sslp	Global Sequence Alignment, RepeatMasker	58kb overlap, GA-rich length polymorphism: 305 bp in AC108448 (near 58042-58235), 78 bp in AC131971, supported by 4 pairs of BAC ends, 8 pairs of fosmid ends	pass		[email protected]
AC087386	AC126603		sslp	repeat masker	broken overlap caused by (CGG)n repeat (311 bp) and G-rich low complexity region (165 bp) in AC126603; join is supported by high % identity across the 27 kb overlap and 13 BAC`s and 12 fosmids which link across the join.	return	Are 13 BAC- and 12 fosmid-ends overrepresentation? Please comment	[email protected]
AC015988	AC107896		other	sequence alignment	Insertion of an AluYa5 repeat element in AC107896. Insertion of ~400bp of a 80bp unknown repeat element in AC107896. Join supported by 4 BACs and 14 fosmids. Total overlap 112kb.	return	is 21 pairs fosmid-ends overrepresentation? Also, unknown insertion requires additional support eg. PCR to support polymorphism	[email protected]
AC107892	AC109314		sslp	repeat masker, sequence alignment	CCCCAGn repeat region is ~50bp longer in AC107892; join supported by 10 BACs and 8 fosmids which link across join. Total overlap 141kb.	pass		[email protected]
AC026950	AC129915		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 18kb. Imperfect 54mer repeat larger by 1838bps in AC129915. 8 supporting BACs, 3 supporting fosmids.	pass		[email protected]
AC103725	AC131568		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 41kb. Break in alignment caused by imperfect 20mer repeat ("CAGAGGGGAACACATGGGGG") larger in AC131568 by 93bps. 4 supporting BACs, 4 supporting fosmids.	pass		[email protected]
AC022206	AC131390		sslp	Non-experimental. Polymorphism in simple sequence repeat of GGAA in AC022206 around 164,300 bp interrupts the alignment.		pass	In future, should include BAC/fosmid end support and extent of polymorphism.	[email protected]
AC027130	AC134300		sslp	Non-experimental. Polymorphism in simple sequence repeat of TA around 5391 bp in AC007613 interrupts the alignment.		pass	in future, please include BAC/fosmid end support and extent/size of variation. This also has a lot of overlap (89kb)) which would be useful to note.	[email protected]
AC127459	AC130450					in process		[email protected]
AC010268	AC130454		sslp	Non-experimental. Polymorphism in simple sequence repeat of AG around 116081 bp in AC010268 interrupts the alignment.		pass	should include BAC/fosmid end support, extensive overlap (49kb), size of polymorphic region	[email protected]
AC009030	AC130449		sslp	Non-experimental. Polymorphism in simple sequence repeats of CT around 137400 bp and GGGAT around 78000 bp in AC130449 interrupts the alignment.		pass	should include BAC/fosmid end support, extensive overlap (49kb), size of polymorphic region	[email protected]
AC005591	AC092117					return	requires additional information. Please include BAC/fosmid end or other support. Please indicate if attempts are being made to resolve.	[email protected]
AC092133	AC135776		sslp	Non-experimental. Polymorphism in simple sequence repeat of AAAAT around 33150 bp in AC092133.	OTHER EVIDENCE: Microdeletion of 538 bp at 29310 bp in AC092133 is being evaluated.	in process	complex, other-likely requires PCR confirmation of polymorphism	[email protected]
AC108134	AJ003147					in process	next round, please include BAC or fosmid end support if any.	[email protected]
AC098805	AC106820		sslp	Non-experimental. Polymorphism in simple sequence repeats around 600-700 bp of AC098805 interrupts the alignment.		return	requires BAC, fosmid end support. Please include size of apparent polymorphism	[email protected]
AC093525	AC106820		sslp	Non-experimental. Polymorphism in simple sequence repeat of AT, around 61 Kb of AC106820 interrupts the alignment.		return	requires BAC, fosmid end support. Please include size of apparent polymorphism	[email protected]
AC025277	AC106783					in process	please include BAC, fosmid end support	[email protected]
AC025280	AC092341		sslp	Non-experimental. Polymorphism in simple sequence repeats at 6 locations interrupt the alignment. Join is supported by multiple BAC and fosmid paired ends.		pass		[email protected]
AC018846	AC092126					in process		[email protected]
AC018552	AC092118		sslp	Non-experimental.	Polymorphism in simple sequence repeat of CCAT around 10500 bp in AC018552 (around 20500 bp in AC092118) interrupts the alignment. CCAT repeat is 1.3 Kb in AC092118 vs 1.74 Kb in AC018552. Supported by multiple BAC and fosmid paired ends.	pass		[email protected]
AC012321	AC092115		other	?	Alu deletion of 99 bp around 101645 bp in AC092115, Microdeletion of 297 bp around 111070 bp in AC092115, and deletion of 4700 bp around 3060 in AC012321 interrupt the alignment. Clones are from different BAC libraries. Join is supported by multiple BAC and fosmid paired ends.	return	Probably OK, but deletion should be confirmed polymorphic eg by PCR.	[email protected]
AC012186	AC092368					in process	will resolve on next punchlist	[email protected]
AC007334	AC007608		sslp	Non-experimental. Polymorphism in simple sequence repeat of G`s and A`s around 71428 bp in AC007334 interrupts the alignment.		pass	should include size of polymorphism, BAC/fosmid end support	[email protected]
AC007602	AC020766		sslp	Non-experimental	Polymorphism in simple sequence repeats of GAAA and CT around 7250 bp in AC007602 interrupts the alignment. Supported by multiple BAC and fosmid paired ends.	return	Potential overrepresentation of BAC- and fosmid-ends. Investigate.	[email protected]
AC007613	AC007616		sslp	Non-experimental. Polymorphism in simple sequence repeat of TA around 5391 bp in AC007613 interrupts the alignment.		pass	OK, but in future include extent of variation and BAC/fosmid end support	[email protected]
AC009069	AC009094		other	Non-experimental.	SSLP and other. Polymorphism in simple sequence repeat of AT around 162370 bp in AC009094 interrupt the alignment. Two Alu polymorphisms, at 106374-106678 bp in AC009069 and 184078-184381 bp in AC009094. Supported by multiple BAC and fosmid paired ends.	pass		[email protected]
AC009088	AC093520		sslp	Non-experimental. Polymorphism in simple sequence repeats at several locations interrupts the alignment.		pass	should include BAC/fosmid end support, extensive overlap (49kb), size of polymorphic region	[email protected]
AC009090	AC023825		sslp	Non-experimental. Polymorphism in simple sequence repeats of CA, and poly-A, around 192112 bp in AC009090 interrupts the alignment.		pass	should include BAC/fosmid end support, length of polymorphism.	[email protected]
AC009155	AC026461		other	Non-experimental.	SSLP and other. Polymorphism in simple sequence repeat of GGAA repeats around 104053 bp in AC009155 interrupts the alignment. Polymorphism between 78050-78823 bp of AC009155 and 146099-147039 bp and microdeletion of 330 bp around 120297 of AC026461 interrupt the alignment. Supported by multiple BAC and fosmid paired ends.	pass		[email protected]
AC004682	AC009087					return	certificate incomplete	[email protected]
AC006352	AC092144					in process		[email protected]
AC003108	AC012621		sslp	Non-experimental. Polymorphism in simple sequence repeat of TA around 53200 bp in AC012621 interrupts the alignment.		pass	Should include BAC, fosmid end support in future	[email protected]
AC002331	AC008756		sslp	Non-experimental. Polymorphism in simple sequence repeats at several location interrupts the alignment. Finishing quality will be evaluated.		in process	please include size of polymorphism, BAC/fosmid end support	[email protected]
AC007842	AC011536		other	no experimental	Clones overlapping in a tandem repeat. Join supported by AC139454 and also 7 other fosmid end pairs	pass		[email protected]
AC008568	AC010482		other	no experimental	123bp indel in AC010482. Join supported by one pair of BAC ends and 2 pairs of fosmid ends.	return	This in/del require s other support, eg PCR.	[email protected]
AC008659	AC093290		other	No experimental	Number of repeats varies between clones. AC008659 is tagged in the GenBank entry as unsure # of repeat copies. Join is supported by 11 pairs of fosmid ends.	return	Is 11 pairs of fosmid-ends overrepresentation? Also, requires additional support eg. PCR	[email protected]
AC008892	AC016596		sslp	no experimental	543bp indel in TA region. Join supported by 1 pair of BAC ends and 1 pair of fosmid ends	pass		[email protected]
AC008939	AC020930				AC008939 clipped too short. Being refinished to extend the overlap.	in process		[email protected]
AC010442	AC106772		other	no experimental	Variation between Caltech D and RP11 clones in telomeric region. Join supported by the draft clone AC138432. Also one other pair of BAC ends and 7 pairs of fosmid ends	pass		[email protected]
AC010470	AC022450		sslp	no experimental	153bp simple sequence polymorphism at the end of the clone. Join supported by 3 pairs of BAC ends.	pass		[email protected]
AC011407	AC090064		sslp	no experimental	185bp indel in TA region. Join supported by 2 pairs of BAC ends.	pass		[email protected]
AC027310	AC027316		other	no experimental	VNTR 29mer attcttatatatattctaagaaatatac repeated twice in AC027310 and 13 times in AC027316. Join supported by 2 pairs of BAC ends.	pass		[email protected]
AC093528	AC094099				AC093528 clipped too short. Being refinished to extend the overlap.	in process		[email protected]
AC114288	AC114307		sslp	no experimental	214bp indel in TA region. Join supported by 5 pairs of BAC ends.	return	Greg`s site lists no supporting BAC or fosmid-ends. requires BAC, fosmid end support or other	[email protected]
AC022093	AC122716				Repeat on the end of the clones. Another clone in progress to reinforce the join.	in process		[email protected]
AC010600	AC020936		sslp	no experimental	147bp indel in TA region. Join supported by 8 pairs of BAC ends.	pass		[email protected]
AL160006	AL355990				overlap between position 89784-91783 in AL160006 and 1-2000 in AL355990	return	Unsure re. the nature of the problem. What type of cert. is this? If previously a blunt/short join, then this is OK, please update certificate or accession to remove. If this is a polymorphic join, please resubmit with type and length of polymorphism.	[email protected], [email protected]
AL139141	AL390718		other	Sequence alignment and manual checking	21000bp overlap between position 155124-176094 in AL390718 and 1-20691 in AL139141. 13bp interruption to alignment at ~164637 in AL390718. Join Supported by 6 pairs BAC ends and 9 pairs Fosmid ends.	pass	Long overlap, small variation.	[email protected]
AL035411	AL365187		sslp	Sequence alignment and manual checking	2263bp oveplap. Variation in overlap and CA repeat at ~1530bp and ~1800bp in AL035411 interupting alignment. Join supported by 3 pairs BAC ends and 7 pairs Fosmid ends.	pass		[email protected]
AC099563	AC114496		other	Sequence alignment and manual checking	93835bp overlap between 93296-186551 in AC114496 and 1-93835 in AC099563. 230bp difference in TA repeat at ~118664bp in AC114496 interrupting alignment. Join Supported by 7 pairs BAC ends and 4 pairs Fosmid ends	pass	Long overlap, small variation.	[email protected]
AC099570	AC099571		other	Sequence alignment and manual checking	86042bp overlap between position 81372-157413 in AC099571 and 1-85817 in AC099570. Disruption in alignment at 87144bp in AC099571. Join Supported by 8 pairs BAC ends and 11 pairs Fosmid ends	pass	Probably OK because of long overlap, and small number of differences.	[email protected]
AC093575	AC095030		other	Sequence alignment and manual checking	44080bp overlap between position 1-43867 in AC095030 and 115151-159238 in AC093575. TA rich tandem repeat showing variation and several in/dels between the two accessions. TA repeat 220bp longer in AC093575 at ~134387bp. Join Supported by 2 pairs BAC ends and 2 pairs Fosmids ends	return	probably OK because of long overlap, but multiple `other` variations need additional support of polymorphism (eg, pcr)	[email protected]
AC092801	AC094022		other	Sequence alignment and manual checking	71918bp overlap between position 79465-151198 in AC092801 and 1-71918 in AC094022. Join supported by 4 pairs BAC ends and 8 pairs Fosmid ends	pass	Probably OK because of long overlap, and small number of differences.	[email protected]
AC009988	AC026395				overlap between position 119060-174398 in AC009988 and 1-55109 in AC026395	pass	Large overlap, even though lack of end-to-end align.	[email protected]
AL157705	AL392103				Join supported by 4 pair(s) of human BAC ends, CTD-2258H15,RP11-148C9,RP11-794O16,RP11-982I3. PCR on genomic sample in process to confirm the overlap.	in process	previously returned	[email protected]
AL365356	BX276080					in process	should drop from list next round	[email protected]
AC012469	AL772287	AC016826			Overlap of 6bp at GAATTC cloning site. Join supported by genomic sequence AC016826 RP11-570J13. Join supported by 1 pair(s) of human BAC ends and 7 pair(s) of human fosmid ends.	pass		[email protected]
AC121340	AC140846		other	resubmisson of AC002357 in process	682 bp N`s are in AC002357.1.	in process		[email protected]
AL590763	BX276092				New this time. In process. Problem caused by error in assembly of AL590763 (MPIMG to correct). Can be avoided temporarily by use of switchpoint in AGP.	in process		[email protected]
AC074034	AC108685	AC106713				pass		[email protected]
AL133277	Z70689				E-certificate previously submitted (NCBI joins).	pass		[email protected]
AL109801	Z68331				Resubmission to produce a 2000 bp overlap is in progress.	in process		[email protected]
AL035609	AL590069				We have exchanged emails about this one earlier. 2000 base overlap.	pass		[email protected]
AL022155	Z70281				Resubmission to produce a 2000 bp overlap is in progress.	in process		[email protected]
AJ271735	AJ271736	none			Originally submitted in one piece as Y19189. Split into two segments by EMBL according to the authors (IIGB). Inclusion of Y19189 will cause problems as it is the secondary accession of each.	disputed	This is an old compound accession on chrX. Almost certainly OK, but technically not according to standard. It is supported by fosmid and BAC end links.	[email protected]
AL008706	AL133546				New this time. 100 base overlap.	pass		[email protected]
AC109993	AL645722				In process. Both sequences have been recently resubmitted by the respective centres (IMB, IIGB). The problem is caused by a small piece of sequence (~4 kb) that is rotated between the two accessions. One must be incorrect as both clones are from the same X chromosome. Evaluation and correction will be carried out by the two centres. Submitted also as E-certificate to NCBI joins.	in process		[email protected]
AF277315	L44140		other	IMB resequenced 676 bp of G6PD intron 2 containing six of the divergent positions in 6 women and 11 men of Caucasian origin. In all checked chromosomes the sequences were identical to AF277315, indicating that L44140 variants represent rare alleles in th	resubmission of L44140 clipped back to 2000 bp overlap with AF277315 would resolve the failure to detect overlap computationally. Join supported by 1 pair BAC ends, 6 pairs fosmid ends.	unresolved	In the strictest sense, this could be seen as unresolved, since the polymorphism was not seen in the panel, but the efforts are as far as anyone could reasonably ask. Please do not resolve by clipping this back. It is preferable to have some mechanism where a user looking at this region could retrieve the certificate to see what additional measures had been taken to confirm. No further action is necessary.	[email protected]
AC003659	AC121344		line	PCR on genomic samples in process to confirm	~400bp LINE element present in AC121344.5 breaks alignment; join is supported high % identity across the overlap	in process	if BAC or fosmid end support is available, PCR is not required	[email protected]
AC108359	AC117405		sslp	PCR on genomic samples in process to confirm	dinucleotide repeat region is ~75bp longer in AC108359; join is supported by 5 pairs of BAC ends	pass	with BAC end support, no further action is required	[email protected]
AC006062	AC073533		sslp	PCR on genomic sample in process to confirm the polymorphism	AG repeat region 350 bp longer in AC006062.4; Join supported by 1 pair of human BAC end.	pass	with BAC end support, no further action is required	[email protected]
AC091810	AL592164				AC091810.2 contains 30 bp of vector sequence. Clipping and resubmission will solve this problem	in process		[email protected]
AC108359	AC112496		sslp	PCR on genomic samples in process to confirm	trinucleotide repeat region is ~765bp longer in AC112496; join is supported by high % identity across the overlap and 5 pairs of BAC ends	pass	with BAC end support, no further action is required	[email protected]
AL591379	AL845321		none		Pericentromeric segmental duplicated region	in process	previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. alignment does not extend to end of AL845321	[email protected]
AL359955	AL445665		none		Pericentromeric segmental duplicated region	in process	previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. alignment does not extend to end of AL445665	[email protected]
AL445595	AL512635				Additional 73bp of sequence in AL445595; GAGCTCGGTACCCGGGGATCTAGAGTACTGGTTGAAACCCGG ATCATGCATCAGTACGCGTGAGCTCGAATTC represents contamination; matches cloning vector - pBACe3.6. Resolve by re-submitting AL445595.	in process		[email protected]
AL163528	AL442637				AL163528 is currently not finished, which is sending the algnment off. Resolve by finishing AL163528	in process		[email protected]
AL163528	AL357614		none		Presence of Ns in finished clone AL357615. Version .7 has been corrected. Join supported by 4 pair(s) of human BAC ends. Join supported by 3 pair(s) of human fosmid ends	in process	Should be resolved in next round	[email protected]
AL355151	AL627230		none		Pericentromeric segmental duplicated region	in process		[email protected]
AL592525	AL954685		none		Pericentromeric segmental duplicated region	disputed	previously returned. This will not be resolved soon.	[email protected]
AL591438	AL627230		none		Pericentromeric segmental duplicated region	in process	previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. no alignment found	[email protected]
AL590711	BX001034		none		Pericentromeric segmental duplicated region	in process	previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. no alignment found	[email protected]
AL445643	BX001034		none		Pericentromeric segmental duplicated region	in process	previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. AL445643 is contained in BX001034	[email protected]
AL359955	AL512605		none		Pericentromeric segmental duplicated region	in process	previously E-CERTIFICATE IN PROCESS. TPF revised in this region. Should wait to resolve through next round of punchlists. internal alignment (no dovetail)	[email protected]
AL591424	AL954642		other	In progress	GC rich tandem 9qtleomeric region. Indel in tandem, 22kb match then 305bp missing from AL954642.9 (RP11-885N19) from 21904. 302bp extra in tandem in AL591424.11 (RP11-424E7) from 135208-135513. Then 66kb match. Also Riethman half YAC in pipeline.	in process		[email protected]
AL162415	BX248098		none		Pericentromeric segmental duplicated region supported by 11 pair(s) of human BAC ends	in process		[email protected]
AL162731	AL591926		none		Pericentromeric segmental duplicated region. Join supported by 6 pair(s) of human BAC ends. Join supported by 15 pair(s) of human fosmid ends	in process		[email protected]
BX005195	BX248112		none		Pericentromeric segmental duplicated region	in process		[email protected]
AL354874	AL391987		none		Pericentromeric segmental duplicated region	in process		[email protected]
AL357615	AL391117		none		Presence of Ns in finished clone AL357615. Version .7 has been corrected. Join supported by 9 pair(s) of human BAC ends. Join supported by 1 pair(s) of human fosmid ends	in process	Should be resolved in next round	[email protected]
AL158832	AL356244		other	To be tested	Alu. 9ptelomeric region. Indels in Alu repeats disrupting join. Join supported by 2 pair(s) of human BAC ends. Join supported by 10 pair(s) of human fosmid ends	in process		[email protected]
AC105266	AC134025		sslp	cross_match, inspection in Consed	Alignment broken by deletions in imperfect `ggaaa` pentanucleotide repeats. Join supported by 6 pairs of BAC ends and 5 pairs of fosmid ends	pass		[email protected]
AC013421	AC140060		none	none	GenBank record for AC140060 is incorrect. The previous version is correct (gi:28460722) and will be updated	in process		[email protected]
AC105765	AC139618		other	None	Gap between this pair is now filled with RP11- 158G18 (Type1) on tpf.	return	On Greg`s site says "sequence_not_yet_analyzed"; May require BAC, fosmid end support or other. Or, may resolve with next compute.	[email protected]
AC134998	AC136189		sslp	PCR on genomic samples in progress to confirm	tandem repeat region is ~150bp longer in AC134998	in process		[email protected]
AC104448	AC134772		other	cross_match, inspection in Consed	SINE/SSLP Three breaks in alignment: First break due to ALU repeats, second due to dinucleotide repeat polymorphism and third break due to ALU repeats copy number. Join supported by 7 pairs of fosmid ends.	pass		[email protected]
AC107304	AC108697		other	sequence	transposon sequence in AC107304 not excised; resubmission in progress	in process		[email protected]
AC025572	AC116991		line	cross_match, RepeatMasker	Alignment broken by a 6Kb LINE insertion in AC116991.2. Join supported by 5 pairs of BAC and 12 pairs of fosmid ends	pass	is 12 pairs fosmid-ends overrepresentation?	[email protected]
AC063927	AC117435		other	PCR on genomic samples in progress to confirm	~255bp insertion in AC063927 breaks alignment Polymorphism; 299 bp AluY insertion in AC112646.9;	in process	requires BAC, fosmid end support or other	[email protected]
AC078788	AC117421		sine		120bp AluY insertion in AC117421.6; Join supported by 2 pairs of human BAC ends	pass		[email protected]
AC087879	AC090052		sslp		GT simple repeat longer in AC087879; join is supported by 2 pairs of BAC ends	pass		[email protected]
AC007934	AC128680		other	PCR on genomic sample in progress to confirm polymorphism	LINE and OTHER. 70 bp insertion and 520 bp L1MB6 insertion in AC128680.6; Join supported by 2 pairs of human BAC ends.	return	`other` requires additional support, eg PCR	[email protected]
AC099047	AC131013		line	PCR on genomic samples in progress to confirm	~8kb LINE element present in AC131013 breaks Alignment	pass	pcr confirm not required	[email protected]
AC112646	AC130888		sine	confirmed by genomic PCR polymorphism	299 bp AluY insertion in AC112646.9;	pass		[email protected]
AC104190	AC124916		sine	cross_match, inspection in Consed	Alignment broken by 131 bases of ALU sequences in AC124916.3. Join supported by 2 pairs of BAC and 3 pairs of fosmid ends.	pass		[email protected]
AC108486	AC109585		other	none	Problem with AC109585 - currently being resubmitted.	pass	Already resolved in TPF	[email protected]
AC099780	AF152364		other	none	Two breaks in the alignment: The first is due to sequence length polymorphisms at 87223 (AC099780 coordinates) and the other is due to dinucleotide repeats polymorphism at 95133. Otherwise join looks OK. Join supported by 7 pairs of BAC and 10 pairs of fosmid ends. PCR validation pending.	in process	OK, but encourage pcr validation	[email protected]
AC103587	AC114398		other	none	310-base internally duplicated region in AC114398 between 225316 and 225625. Another copy between 223978 and 224287. Join supported by 4 pairs of BAC and 3 pairs of fosmid ends. PCR validation pending.	in process		[email protected]
AC096917	AF152363		other	cross_match, inspection in Consed	AF152363 not finished to current standards. Looks OK.	in process	already removed from punchlist	[email protected]
AC026305	AC068757		sslp	PCR on genomic samples in progress to confirm	tandem repeat region is ~225bp longer in AC026305	pass	pcr not required	[email protected]
AC089985	AC090051		sine		AluYb8 element present in AC090051 breaks alignment; join supported by 6 pairs of BAC ends	pass		[email protected]
AC034187	AC068312		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 41kb. Break in alignment caused by imperfect 80mer repeat that is 876bps larger in AC034187. 4 supporting BACs, 5 supporting fosmids.	pass		[email protected]
AC046134	AC110716		sslp	join is supported by 7 pairs of human BAC ends	GT simple repeat region 10 bp longer in AC110716.5	pass		[email protected]
AC069261	AC073916		none	none	AC069261 is being resubmitted (see gi:22094222)	in process	will disappear	[email protected]
AC018842	AC066608		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 52kb. Break in alignment caused by a simple repeat (TA)n larger in AC066608 by 686bps. 2 supporting BACs, 6 supporting fosmids.	pass		[email protected]
AC021999	AC090955		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 98kb. Break in alignment caused by two simple repeats (CA)n and (TA)n larger in AC021999 by 152bps. 3 supporting BACs, 9 supporting fosmids.	pass		[email protected]
AC023481	AC087859		other	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 55kb. Break in alignment caused by SVA repeats larger in AC087859.3 by 508bps. 1 supporting BACs, 5 supporting fosmids.	pass		[email protected]
AC024163	AC026194		sine	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 88kb. Two breaks in alignment caused by two 322bp SINE insertion in AC024163. 5 supporting BACs, 5 supportings fosmids.	pass		[email protected]
AC006205	AC021054		sslp	correct sequence alignment	AC006205 was resubmitted, eliminating problem	in process		[email protected]
AC004216	AC007425		sslp		repeat region ~500bp longer in AC007425; join is supported by 3 pairs of BAC ends	pass		[email protected]
AC004801	AC074029		sslp		TA repeat region ~200bp longer in AC074029; join supported by 4 pairs of BAC ends	pass		[email protected]
AC010370	AC026118		sslp	Join supported by 4 pairs of human BAC ends	tandem repeat 200 bp longer in AC026118.17	pass		[email protected]
AC009811	AC055712		other		157 bp insertion in AC055712.13; Join supported by 4 pairs of human BAC ends	return	`other` requires additional support eg pcr.	[email protected]
AC006512	U47924		other	sequence alignment	n`s in submission; resubmission in progress	in process		[email protected]
AC011609	AC087428		sine	Global Sequence Alignment, RepeatMasker, Blast2	overlap of 60kb. Break in alignment caused by a SINE repeat larger in AC011609 by 267bps. 4 supporting BACs, 4 supporting fosmids.	pass		[email protected]
AC010200	AC010209		other	sequence alignment	n`s in submission; resubmission in progress	in process		[email protected]]
AC073244	AC092969					in process		[email protected]]
AC093927	AC098971		none		AC093927 contains vector sequence on the ends; UWGC is filtering and resubmitting; join is supported by 6 pair of BAC-ends	in process		[email protected]]
AC092947	AC130416					in process		[email protected]]
AC091212	AC108678					in process		[email protected]]
AC079602	Z98941		none	?	clone pair is currently being analyzed; join is supported by 2 pair of BAC-ends	in process	may need pcr analysis if variation is not simple	[email protected]]
AC087447	AC103854	AC090163			6 bp overlap supported by finished GenBank sequence AC090163.10 (RP11-706A13)	pass		[email protected]
AC023080	AC134982	AC126324			6 bp overlap supported by finished GenBank sequence AC126324.3 (RP11-358H20)	pass		[email protected]
AP000807	AP002813	AP002366			6 bp overlap supported by finished GenBank sequence AP002366.4 (RP11-142N13)	pass		[email protected]
AP001189	AP003119	AP003101			6 bp overlap supported by finished GenBank sequence AP003101.2 (RP11-30J7)	pass		[email protected]
AP003120	AP006215	AC026168			6 bp overlap supported by finished GenBank sequence AC026168.3 (RP11-156E23)	pass		[email protected]
AP001790	AP001876	AP000652			6 bp overlap supported by finished GenBank sequence AP000652.4 (CMB9-8G5)	pass		[email protected]
AP000848	AP003781	AP000929			6 bp overlap supported by finished GenBank sequence AP000929.5 (RP11-778B17)	pass		[email protected]
AP002453	AP003387	AP003384			6 bp overlap supported by finished GenBank sequence AP003384.2 (RP11-35N19)	pass		[email protected]
AP005435	AP005814		other	Blast2, RepeatMasker	SINE/LINE/SSLP. Overlap of 28 kb. Break in alignment caused by deletion of six neighboring SINE/LINE/DNA elements and a (CTTTG)n region for a total of 6014 bp found in AP005435 but not present in AP005814. Join supported by 3 pairs of human BAC ends.	pass	multiple, but fairly straightforward	[email protected]
AP001166	AP005202		other	Blast2, Tandem Repeats Finder, RepeatMasker	Overlap of 37 kb. Break in alignment caused by near-perfect 14-mer repeat (CATGGCCCTATATG) that is 364 bp longer in AP001166. There are 34.1 copies in AP001166 and 8.1 copies in AP005202. Join supported by 2 pairs of human BAC ends and 5 pairs of human fosmid ends.	pass		[email protected]
AP001028	AP001029		line	Blast2, RepeatMasker	Overlap of 118 kb. Break in alignment caused by deletion of a 6228 bp LINE/L1HS element found in AP001028 but not present in AP001029. Join supported by 1 pair of human BAC ends and 11 pairs of human fosmid ends.	pass	is 11 pairs fosmid-ends overrepresentation?	[email protected]
AP003783	AP005401		other	Blast2, RepeatMasker	LTR/SSLP. Overlap of 6.3 kb. Break in alignment caused by deletion of LTR/ERVL element and a (TA)n region for a total of 235 bp found at the end AP003783 but not present in AP005401. Join supported by 2 pairs of human BAC ends and 1 pair of human fosmid ends. The sequence will be confirmed.	pass	encourage additional confirmation in process	[email protected]
AP005232	AP005379		other	Blast2, Tandem Repeats Finder	Overlap of 24 kb. Break in alignment caused by imperfect 15-mer repeat (ATCATCATCATCACC) that is 198 bp longer in AP005379. There are 39.7 copies in AP005379 and 16.6 copies in AP005232. No supporting BACs/fosmids, but otherwise high % identity.	return	requires BAC, fosmid end support or other	[email protected]
AP003037	AP003108		other	Blast2, RepeatMasker	SINE/LINE. Overlap of 14 kb. Break in alignment caused by deletion of two neighboring SINE/LINE elements for a total of 338 bp found in AP003108 but not present in AP003037. Join supported by 4 pairs of human BAC ends and 5 pairs of human fosmid ends. Also confirmed by PCR.	pass		[email protected]
AP003395	AP003396		other	Blast2, RepeatMasker	Overlap of 71 kb. Break in alignment caused by deletion of 216 bp in an SVA element in AP003396. Join supported by 2 pairs of human BAC ends and 10 pairs of human fosmid ends.	pass		[email protected]
AP003500	AP003782		other	Blast2, Tandem Repeats Finder	Overlap of 60 kb. Break in alignment caused by imperfect 34-mer repeat (ATATATTCTACAGAATACGTATATTCTATTCTAC) that is 314 bp longer in AP003500. There are 21.3 copies in AP003782 and 30.3 copies in AP003500. Join supported by 2 pairs of human BAC ends and 7 pairs of human fosmid ends.	pass	VNTR	[email protected]
AP003780	U73634				Overlap of 15 kb. U73634 is an old cosmid clone of questionable quality finished at University of Texas Southwestern Medical Center. The last 164 bases of U73634 do not match the corresponding region of AP003780. We are going to replace U73634 with another clone, RP11-466C23.	in process		[email protected]
AP000311	AP000312	none			Short overlap is an artifact of the nested deletion method. Briefly, a library of nested deletion clones was constructed, a map was then made by using the end sequences from multiple restriction fragments, the overlaps for each clone were confirmed by sequencing, and finally a minimal set of clones was chosen for finishing. Join supported by 1 pair of human fosmid ends.	disputed	Likely to be OK. However, sequencing by nested deletions was not discussed in view of the certificates. Computational verification will not be possible without a spanning clone under current criteria.	[email protected]
AP000336	AP000337	none			Short overlap is an artifact of the nested deletion method. Briefly, a library of nested deletion clones was constructed, a map was then made by using the end sequences from multiple restriction fragments, the overlaps for each clone were confirmed by sequencing, and finally a minimal set of clones was chosen for finishing. Join supported by 1 pair of human BAC ends and 2 pairs of human fosmid ends.	disputed	Likely to be OK. However, sequencing by nested deletions was not discussed in view of the certificates. Computational verification will not be possible without a spanning clone under current criteria.	[email protected]
AP000438	AP001160		other	Blast2, RepeatMasker	SINE/LINE. Overlap of 74 kb. Break in alignment caused by deletion of two neighboring SINE/LINE elements for a total of 460 bp found in AP001160 but not present in AP000438. Join supported by 5 pairs of human BAC ends and 2 pairs of human fosmid ends.	pass		[email protected]
AP000689	AP000690		sine	Blast2, RepeatMasker	Overlap of 7.6 kb. Break in alignment caused by deletion of a 299 bp SINE/AluSg element found in AP000690 but not present in AP000689. Join supported by 1 pair of human fosmid ends.	pass		[email protected]
AP000702	AP000703				Break in alignment caused by a ~26 kb deletion in AP000702 between bases 38400 and 38401 which is covered by AP000703 and AP000704; the next few hundred bases after the deletion point are chimeric, so the last 2475 bp are not used in the AGP. Join supported by 1 pair of human fosmid ends.	return	requires additional support eg. Pcr.	[email protected]
AP000708	AP003069		other	Blast2, Tandem Repeats Finder	Overlap of 63 kb. Break in alignment caused by near perfect 125-mer repeat (CAGCACGGCCACTAGCTCTGCTCAAGAAACAAGTCTGCGTC TCCTTATTGTGCTAGTTCATTCCTCAGTTCACTACACAATCCT TCAACGTTGGCCTCTTTGCCTGTCTGCACACTGTGCCTGGT) that is 107 bp longer in AP000708. There is 1 copy in AP003069 and 2 copies in AP000708. Join supported by 2 pairs of human BAC ends and 11 pairs of human fosmid ends.	pass	VNTR; Is 11 pairs fosmid-ends overrepresentation?	[email protected]
AP000729	AP001885		sslp	Blast2, Tandem Repeats Finder, RepeatMasker	Overlap of 6.5 kb. Break in alignment caused by simple repeat (TG)n that is 12 bp longer in AP001885. There are 17 copies in AP000729 and 23 copies in AP001885. Join supported by 2 pairs of human BAC ends and 2 pairs of human fosmid ends.	pass		[email protected]
AP000924	AP001883				Join supported by 2 pairs of human BAC ends and 2 pairs of human fosmid ends. Overlap of 60 kb. The last 43 bp of AP000924 do not match the corresponding position within AP001883, the sequence will be confirmed. There is high % identity otherwise.	in process		[email protected]
AP000926	AP003040		sine	Blast2, RepeatMasker	Overlap of 4 kb. Break in alignment caused by deletion of three neighboring SINE elements and an AT_rich region for a total of 1146 bp found in AP000926 but not present in AP003040. Join supported by 3 pairs of human BAC ends and 1 pair of human fosmid ends.	pass		[email protected]
AP001050	AP001051		other	Blast2, Tandem Repeats Finder	Overlap of 27 kb. Break in alignment caused by imperfect 20-mer repeat (TGCTGAGGGAGATGAGGGCC) that is 504 bp longer in AP001051. There are 95.9 copies in AP001050 and 120.9 copies in AP001051. Join supported by 3 pairs of human fosmid ends.	pass		[email protected]
AP001064	AP001065		other	Blast2, Tandem Repeats Finder	Overlap of 25 kb. Break in alignment caused by imperfect 41-mer repeat (CACTGTCTTGGTTGGCGTAGCCTTGTAGTAAGTTTTGACCG) that is 727 bp longer in AP001065. There are 25.9 copies in AP001064 and 40.9 copies in AP001065. Join supported by 1 pair of human fosmid ends.	pass		[email protected]
AP001620	AP001621		other	Blast2, Tandem Repeats Finder	Overlap of 20 kb. Break in alignment caused by imperfect 50-mer repeat (CAACACCTCCATCACCAACAGAAACCAGGCGGGGCCAGCTGA CCCCAGAG) that is 235 bp longer in AP001620. There are 13.1 copies in AP001620 and 8.1 copies in AP001621. Join supported by 1 pair of human BAC ends and 5 pairs of human fosmid ends.	pass		[email protected]
AP001625	AP001626		other	Blast2, Tandem Repeats Finder	Overlap of 39 kb. Break in alignment caused by imperfect 51-mer repeat (AGCCTCCCGCCCCGTTTACATCCACGCAGGCGTTTCCCCTT ACCTGCACCG) that is 2023 bp longer in AP001625. There are 58 copies in AP001625 and 16.4 copies in AP001626. Join supported by 1 pair of human BAC ends and 10 pairs of human fosmid ends.	pass		[email protected]
AP001874	AP003170		sine	Blast2, RepeatMasker	Overlap of 55 kb. Break in alignment caused by deletion of 1485 bp of SINE/Alu elements found in AP001874 but not present in AP003170. Join supported by 4 pairs of human BAC ends and 3 pairs of human fosmid ends.	pass		[email protected]
AP001883	AP001980		other	Blast2, Tandem Repeats Finder	Overlap of 31 kb. Break in alignment caused by imperfect 17-mer repeat (AGAGTATATGCAGTGAT) that is 223 bp longer in AP001980. There are 65.2 copies in AP001883 and 79.2 copies in AP001980. Join supported by 2 pairs of human BAC ends and 1 pair of human fosmid ends. In addition, the first 10 bp of AP001980 do not match the corresponding position within AP001883, the sequence will be confirmed.	pass		[email protected]
AP001925	AP002433		other	Blast2, RepeatMasker	SINE/LINE/SSLP. Overlap of 16 kb. Break in alignment caused by deletion of six neighboring SINE/LINE elements and a (TA)n region for a total of 1382 bp found in AP002433 but not present in AP001925. Join supported by 7 pairs of human BAC ends and 5 pairs of human fosmid ends.	pass	multiple, but fairly straightforward	[email protected]
AP001994	AP003390		sine	Blast2, RepeatMasker	Overlap of 97 kb. Break in alignment caused by deletion of a 264 bp SINE/AluYa5a2 element found in AP001994 but not present in AP003390. Join supported by 6 pairs of human BAC ends and 19 pairs of human fosmid ends.	return	Probably OK, but is 19 pairs fosmid-ends overrepresentation? Please comment.	[email protected]
AL109761	AP000432		sslp	Blast2, Tandem Repeats Finder, RepeatMasker	Break in alignment caused by simple repeat (T)n that is 22 bp longer in AP000432. There are 42 copies in AP000432 and 20 copies in AL109761. Join supported by excellent sequence alignment. Join supported by 2 pairs of human BAC ends and 1 pair of human fosmid ends.	pass		[email protected]
AF020802	AP000687		other	Blast2, RepeatMasker	Overlap of 52 kb. Break in alignment caused by partial deletion of a SVA element which is 231 bp longer in AP000687 than in AF020802. Join supported by 4 pairs of human fosmid ends.	pass		[email protected]
AF045449	AF064857		other	Blast2, Tandem Repeats Finder	Overlap of 12 kb. Break in alignment caused by two neighboring imperfect repeats, the first is a 59-mer (TGTTGGCCTCCTTTTCCTATTGCCTTCTCCTCAATGCCTGTG TCTGAAATTGCCATAGG) and the second is a 74-mer (ATAGGTGTTGGCCTCCTTTTCCTATTGCCTTCTCCTCTATGCC TGTGTCTGAAATTGCCCTCCACCCTTCTCTT) which results in AF045449 being 198 bp longer. There are 1.9 copies of the 51-mer and 7.1 copies of the 74-mer in AF064857. There are 3.9 copies of the 51-mer and 8.1 copies of the 74-mer in AF045449. Join supported by 2 pairs of human fosmid ends.	pass		[email protected]
AF135405	AP001138				There is an 85 kb deletion in AF135405 which is covered by AP001138.	return	requires additional confirmation that deletion is a polymorphism eg by pcr.	[email protected]
AF227510	AF260011		other	Blast2, RepeatMasker	SINE/LINE. Overlap of 30 kb. Break in alignment caused by deletion of a 311 bp SINE/AluY element and a 217 bp LINE/L1MC1 element both found in AF227510 but not present in AF260011. Join supported by 2 pairs of human BAC ends and 2 pairs of human fosmid ends.	pass	multiple, but straightforward	[email protected]
AF240627	AL109763		other	Blast2, RepeatMasker, Tandem Repeats Finder	LINE/other. Overlap of 105 kb. Break in alignment caused by two differences. The first is a variation in a LINE/L1 element which is about 300 bp shorter in AF240627. The second is caused by an imperfect 50-mer repeat (GGCACGCCATTCCCTGTTACCTGCATCAGTGACTGATCAGA ATGGGGTAA) that is 250 bp longer in AF240627. There are 8.9 copies in AL109763 and 14.9 copies in AF240627. Join supported by 1 pair of human BAC ends and 7 pairs of human fosmid ends.	pass	VNTR	[email protected]
AC027239	AP001998		other	Blast2, RepeatMasker	LINE/SSLP. Overlap of 68 kb. Break in alignment caused by deletion of two neighboring LINE/L1HS elements and a (A)n region for a total of 1637 bp found in AC027239 but not present in AP001998. Join supported by 10 pairs of human BAC ends. Another clone, RP11-24F19, is being sequenced to confirm this overlap.	in process		[email protected]
AC073071	AC073387	AC073103			Minimal overlap was finished, but AC073103 confirms overlap. Overlap also supported by BAC end pairs.	pass		[email protected]
AC073081	AC109822		sine	polymorphic based on genomic pcr assay	Alu. AC073081.5 contains 312bp more data than AC109822.5, indel present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC073094	AC091729		other	polymorphic based on genomic pcr assay	indel present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join also supported by fosmid and bac end pairs	pass		[email protected]
AC073216	AC093655		other	polymorphic based on genomic pcr assay	AC093655.4 contains 150 bp more than AC073216.7, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC073236	AF109076		other	polymorphic based on genomic pcr assay	AC073236.8 contains 231bp more than AF109076.1, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC068196	AC104076		sine	repeatmasker	Alu. 68409 bp overlap, AC104076.5 contains 313bp more data than AC068196.4, AC068196.4 contains 295bp more data than AC104076.5, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC058823	AC108159		other	repeatmasker	LTR/MaLR, LINE/L2, SINE/MIR, DNA/MER2_type. 44728 bp overlap, AC058823.4 contains 2196bp more data than AC108159.5, join supported by bac and fosmid end pairs	pass		[email protected]
AC066692	AC079924		other	polymorphic based on genomic pcr assay	SINE/Alu, LINE/L1. AC066692.3 contains 541bp more data than AC079924.6, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC073249	AF104455	AC073249			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC073336	AC093726	AC073077			Minimal overlap was finished, but AC073077 confirms overlap. Overlap also supported by BAC and fosmid end pairs.	pass		[email protected]
AC073344	AC093592		sine	polymorphic based on genomic pcr assay	Alu. AC073344.7 contains 298bp and 307bp more data than AC093592.3, multiple indels also present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	pass		[email protected]
AC073879	AC108929		sine	polymorphic based on genomic pcr assay	Alu. AC073879.7 contains 4bp more data than AC108929.4, AC108929.4 contains 1982bp more data than AC073879.7, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC074257	AC093583		other	polymorphic based on genomic pcr assay	AC074257.5 contains 1165bp more than AC093583.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass	11 fosmid-ends - is this overrepresentation?	[email protected]
AC068537	AC110807		line	polymorphic based on genomic pcr assay	L2. AC110807.3 contains 218bp more data than AC068537.5, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC025561	AC093764		other	polymorphic based on genomic pcr assay	2084 bp overlap, indel present, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC025821	AC093803		other	polymorphic based on genomic pcr assay	SINE/Alu, LTR/ERV1, LINE/L2, LINE/L1. AC093803.3 contains 8489bp more data than AC025821.7, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	pass		[email protected]
AC020601	AC093674	AC019304			another accession sequenced to confirm join	pass		[email protected]
AC021127	AC105917	AC025602			another accession sequenced to confirm join	pass		[email protected]
AC107464	AC139887		line	repeatmasker	L1. 4p telomere, 91687 bp overlap, AC139887.1 contains 1003bp more than AC107464.5, AC107464.5 contains 133bp more than AC139887.1, multiple indels present, supported by bac and fosmid end pairs	pass		[email protected]
AC093877	AC131947		sine	polymorphic based on genomic pcr assay	Alu. multiple indels present, join supported by bac and fosmid endpairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC019195	AL133244	AC019195			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC093886	AC131945		other	polymorphic based on genomic pcr assay	SINE/Alu, LINE/L1. AC131945.1 contains 226bp more data than AC093886.2, AC093886.2 contains 6062bp more data than AC131945.1, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC017084	AC022201		other	repeatmasker	DNA/MER1_type. AC017084.8 contains 14bp more data than AC022201.4, join is also supported by fosmid end pairs	pass		[email protected]
AC018643	AC105443		other		62648bp overlap, AC105443.2 contains 15bp more on the end than AC018643.3, this is UWGC clone, we will contact them to see if this is possibly a vector issue. overlap supported by bac and fosmid end pairs	in process		[email protected]
AC018645	AC018648		sine	repeatmasker	Alu. 27084bp overlap, AC018648.5 contains 551bp more than AC018645.4	pass		[email protected]
AC018678	AC062032	AC079297			another accession sequenced to confirm join	pass		[email protected]
AC018804	AC018865		other	in progress	66488 bp overlap, multiple indels present, join is also supported by bac and fosmid end pairs	return	12 bac-end and 16 fosmid-end links - is this overrepresentation? May require additional support eg. PCR	[email protected]
AC108938	AC112229		other	repeatmasker	LINE/L2, SINE/Alu, LTR/ERVL 88635 bp overlap, multiple indels-resulting in AC112229.4 containing 19bp more data than AC108938.3	return	requires BAC, fosmid end support or other	[email protected]
AC106892	AC110798		sine	polymorphic based on genomic pcr assay	Alu. AC106892.3 contains 264bp msore data than AC110798.4, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC107048	AC108164		sine	polymorphic based on genomic pcr assay	Alu. 78104 bp overlap, AC107048.3 contains 307bp, 304bp, 50bp, and 337bp more than AC108164.5, join supported by fosmid end pair, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC107214	AC108477		sine	polymorphic based on genomic pcr assay	Alu. multiple indels present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by fosmid end pairs	pass		[email protected]
AC104809	AC112784		other	polymorphic based on genomic pcr assay	14444 bp overlap, AC104809.5 contains 164bp more data than AC112784.4, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC104068	AC104795		sine	polymorphic based on genomic pcr assay	Alu. AC104068.3 contains 305bp more data than AC104795.1, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	pass		[email protected]
AC095041	AC108205		other	polymorphic based on genomic pcr assay	LINE/L1, DNA/MER1_type, LTR/ERVL. AC108205.5 contains 5796bp more data than AC095041.3, multiple indels also present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	pass		[email protected]
AC096576	AC107462		sine	polymorphic based on genomic pcr assay	AC096576.3 contains 190bp more data than AC107462.5, AC107462.5 contains 1885bp more data than AC096576.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	return	Probably OK, but 17 BAC-ends - is this overrepresentation?	[email protected]
AC093164	AC104695		other	polymorphic based on genomic pcr assay	SINE/Alu, LINE/L1. indel present, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC097108	AC098870		other	polymorphic based on genomic pcr assay	indel present, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC097526	AC107208		other	polymorphic based on genomic pcr assay	AC107208.6 contains 108bp more data than AC097526.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	pass		[email protected]
AC093627	AC093666		line	repeatmasker	L1. 7p telomeric, 145213bp overlap, AC093627.4 contains 290bp and 32bp more than AC093666.4, join is also supported by bac and fosmid end pairs	return	possible over-representation of fosmid links (16). Please check and comment	[email protected]
AC093689	AC093771		other	polymorphic based on genomic pcr assay	AC093771.3 contains 198bp more data than AC093689.4, AC093689.4 contains 704bp more data than AC093771.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	pass		[email protected]
AC093724	AC103564		other		AC093724.2 will be resubmitted this clone previously had a misassembly	in process	Please return certificate if not resolved; otherwise should resolve with new compute	[email protected]
AC093860	AC108060	AC023350			another accession sequenced to confirm join	pass		[email protected]
AC092106	AC114755		other	repeatmasker	SINE/Alu, LTR/ERV1, LINE/L1. AC092106.5 contains 6350bp more data than AC114755.4, join is also supported by bac and fosmid end pairs	pass	This is at the edge of passing due to multiple variations.	[email protected]
AC092442	AC113615	AC004624			Minimal overlap finished, but AC004624 confirms overlap. Overlap also supported by BAC and fosmid end pairs.	pass		[email protected]
AC092463	AC106045		other	polymorphic based on genomic pcr assay	LTR/MaLR, SINE/Alu. AC106045.5 contains 2432bp more data than AC092463.5, AC092463.5 contains 488bp more data than AC106045.5, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass	12 fosmid-ends - is this overrepresentation?	[email protected]
AC092619	AC113618		line	polymorphic based on genomic pcr assay	L1. AC113618.5 contains 1331bp more data than AC092619.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass	11 fosmid-ends - is this overrepresentation?	[email protected]
AC092628	AC099552		other	polymorphic based on genomic pcr assay	multiple indels, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass	13 fosmid-end links - is this overrepresentation?	[email protected]
AC092683	AC099646	AC092683			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC092685	AC104073		other	polymorphic based on genomic pcr assay	AC092685.2 contains 4099 bp more data than AC104073.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC079255	AF093117	AC079255			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC079402	AC079769		other	in progress	2000 bp overlap, indel present due to simple repeat	return	requires BAC, fosmid end support or other; probably OK if this can be supplied	[email protected]
AC079837	AL133243		other	?	we think this might be extra vector on AL133243.1, this is GS clone, we are clipping it back manually in the agp file. This join is supported by bac and fosmid end pairs	in process	Please return certificate when resolved; or, if extra vector, will resolve on next compute	[email protected]
AC006334	AC073330		sslp	in progress	AC073330.6 contains 721bp more than AC006334.3. Low complexity, simple repeats. Join is supported by both fosmid and bac end pairs	return	Greg`s site says over 20 kb difference, please investigate	[email protected]
AC006433	AC069288	AC069288			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC006445	AC020729	AC020729			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC006226	AC020729	AC020729			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC006230	AC025539	AC025539			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC004166	AC083884		sine	william`s region - will not be tested	Alu. AC004166.12 contains 179bp more than AC083884.6,join is also supported by bac and fosmid end pairs	disputed	12 BAC- and 27 fosmid-ends -likely to be over-representation or complications due to William`s region. Since further work is not likely to be enlightening in the short term, this remains disputed.	[email protected]
AC004841	AC093799		other	polymorphic based on genomic pcr assay	AC093799.2 contains 791bp more than AC004841.2, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC004936	AC010991	AC010991			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC005015	AC005081		other	polymorphic based on genomic pcr assay	AC005015.2 contains 460bp more than AC005081.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC005056	AC005057	AC004956			Minimal overlap was finished, but AC004956 confirms overlap. Overlap also supported by BAC and fosmid end pairs.	pass		[email protected]
AC005061	AC099759		other	polymorphic based on genomic pcr assay	assayed base differences in both clones as well as the 1958 indel and found both to be polymorphic	pass		[email protected]
AC005072	AC005103	AC005072			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC005086	AC005103		other	polymorphic based on genomic pcr assay	AC005103.3 contains 164 bp more than AC005086.2, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC005237	AC111201		other	in progress	1986 bp overlap, AC111201.5 contains 13bp more data than AC005237.2	return	requires BAC, fosmid end support or other	[email protected]
AC005326	AC079781		other	polymorphic based on genomic pcr assay	AC005326.2 contains 333bp more than AC079781.7, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC005598	AC108063		sslp	repeatmasker	1983 bp overlap, AC108063.3 contains 19bp more data than AC005598.6, join supported by bac and fosmid end pairs	pass		[email protected]
AC005674	AC108199		sine	polymorphic based on genomic pcr assay	Alu. 89047 bp overlap, AC108199.5 contains 232bp and 306bp more data than AC005674.11, join supported by fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC005699	AC025539	AC025539			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC003093	AC005084	AC084148			Minimal overlap was finished, but AC084148 confirms overlap. Overlap also supported by BAC and fosmid end pairs.	pass		[email protected]
AC002385	AC092465		other	polymorphic based on genomic pcr assay	AC002385.1 contains 6028 bp more than AC092465.5 , bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC004027	AC079799		other	polymorphic based on genomic pcr assay	bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	pass		[email protected]
AC002088	AC002124	AC007555			Minimal overlap was finished, but AC007555 confirms overlap. Overlap also supported by BAC and fosmid end pairs.	pass		[email protected]
AC011893	AC016742	AC012551			another accession sequenced to confirm join	pass		[email protected]
AC011744	AC105415		sine	polymorphic based on genomic pcr assay	Alu. AC105415.2 contains 334bp more data than AC011744.8, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	return	Almost certainly OK, but 16 fosmid-ends - is that overrepresentation?	[email protected]
AC011228	AC019210		other	repeatmasker	LTR/ERVL, LINE/L1. an indel is present in each accession at different places, 567bp more in AC011228.9, and 356 bp more in AC019210.7, supported by both fosmid and bac end pairs	return	Multiple with InDels, probably needs additional conmfirmation	[email protected]
AC010743	AL121654	AC010743			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC010743	AL121657	AC010743			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC010913	AC012366	AC073630			another accession sequenced to confirm join	pass		[email protected]
AC011005	AC083866		other	repeatmasker	SINE/Alu, LINE/L1. Indels present, join is also supported by bac and fosmid end pairs	return	Probably OK, but if indels are extensive requires additional support eg. PCR	[email protected]
AC011005	AC018639		sine	repeatmasker	Alu. AC011005.7 contains 673 bp more than AC018639.8, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC012513	AC069155		other	polymorphic based on genomic pcr assay	AC012513.12 contains 2556bp more data than AC069155.6, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC013399	AC079988		other	polymorphic based on genomic pcr assay	SINE/Alu, LTR/MaLR. AC079988.6 contains 298bp more data than AC013399.6, AC013399.6 contains 606bp more data than AC079988.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC013480	AC083949	AC013480			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC013733	AC073977		sine	polymorphic based on genomic pcr assay	Alu. AC013733.10 contains 305bp more data than AC073977.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC015976	AC114745		other	polymorphic based on genomic pcr assay	SINE/Alu, LINE/L1, DNA/MER1_type. 117889 bp overlap, AC015976.8 contains 8425bp more data than AC114745.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC016692	AC064852		sine	repeatmasker	Alu. 2000 bp overlap, AC064852.4 contains 291bp more data than AC016692.9, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC016711	AC023430	AC016711			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC016759	AC107209		sine	polymorphic based on genomic pcr assay	Alu. AC107209.4 contains 316bp more data than AC016759.11, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC006840	AC114736		line	polymorphic based on genomic pcr assay	L1. AC006840.17 contains 6085bp more data than AC114736.4, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join supported by bac and fosmid end pairs	pass		[email protected]
AC007073	AC113614		other	polymorphic based on genomic pcr assay	LTR/MaLR. AC113614.4 contains 548bp more data than AC007073.2, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC007189	AC079394	AC079394			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC008039	AC018662		sine	repeatmasker	Alu. AC008039.1 contains 301bp more than AC018662.3, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC008122	AC019178	AC019178			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC008122	AC013468	AC013468			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC009264	AC009332		sslp	repeatmasker	AC009264.6 contains 295bp more than AC009332.6, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC009274	AC016831		line	repeatmasker	L1. 24267bp overlap, AC009274.11 contains 1064bp more than AC016831.1	pass		[email protected]
AC009958	AC110080		line	to be tested	indels in both accessions, will test to confirm overlap	in process	For a simple variation, BAC or fosmid end data likely sufficient to confirm. If compound or not a recent LINE, may be preferable to confirm variation by genomic PCR.	[email protected]
AC010095	AC073415		other	polymorphic based on genomic pcr assay	SINE/Alu, LINE/L1. AC010095.6 contains 1556bp more data than AC073415.6, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC009332	AC108510		sslp	repeatmasker	AC108510.2 contains 339 bp more than AC009332.6, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC009336	AC016739	AC016739			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AL121654	AL133247		line	repeatmasker	L1. 49041 bp overlap, AL133247.1 contains 1505bp more data than AL121654.1, join supported by bac and fosmid end pairs	pass		[email protected]
AL121656	AL133244		sine	repeatmasker	28401 bp overlap, indel present	return	requires BAC, fosmid end support or other; if indel, may need PCR support	[email protected]
AL121796	AL590235		other	repeatmasker	LINE/L1, simple_repeat. 64378 bp overlap, multiple indels present- mostly due to a dinucleotide repeat	return	requires BAC, fosmid end support or other	[email protected]
AC016674	AC092169		line	polymorphic based on genomic pcr assay	L1. AC016674.9 contains 6039bp more data than AC092169.4, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC018678	AC069333	AC026337			another accession sequenced to confirm join	pass		[email protected]
AC018687	AF250324	AC018687			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC097493	AC118279	AC118279			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC107397	AC121155		none		this was a vector clipping problem, it has been fixed with AC107397.5	pass		[email protected]
AC113607	AC116614		other	polymorphic based on genomic pcr assay	multiple indels, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC093898	AC121160		other	polymorphic based on genomic pcr assay	indel present, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC019341	AC121161		line	polymorphic based on genomic pcr assay	L1. AC121161.2 contains 175bp more data than AC019341.6, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass	12 fosmid-ends - is this overrepresentation?	[email protected]
AC104597	U66061		other	polymorphic	U66061.1 contains 10 kb more than AC104597.3, within the 10 kb is T Cell Receptor Beta Locus, NG_001333.1, join is also supported by bac and fosmid end pairs	return	17 fosmid-ends - is this overrepresentation? May require additional support eg. PCR; may be intractable due to TCR locus; if so, `disputed` or `unresolved`	[email protected]
AC009961	AC093873	AC087594			another accession finished to confirm join	pass		[email protected]
AC105446	AC118759		other	repeatmasker	1220 bp overlap; SINE/Alu; multiple indels in overlap, high number of substitutions, have fosmids picked in this area to confirm overlap	return	This is really an `other`; there is a SINE present, but also multiple other differences. Likely requires more than just BAC or fosmid support	[email protected]
AC099799	AC116176		other	polymorphic based on genomic pcr assay	AC116176.4 contains 189bp more data than AC099799.6, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass		[email protected]
AC113607	AC116609		other	polymorphic based on genomic pcr assay	LINE/L1, SINE/Alu, LTR/MaLR. AC116609.6 contains 4152bp more data than AC113607.3, bp differences in the overlap were assayed and the overlap was found to be polymorphic, join is also supported by bac and fosmid end pairs	pass	13 fosmid end links---over-representation of fosmid-ends? Investigate.	[email protected]
AC114808	AC116614		other	polymorphic based on genomic pcr assay	2ptelomeric region, indel in overlap, 200 bases more in AC114808.4, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC108866	AC116647		line	polymorphic based on genomic pcr assay	L1. 2205 bp overlap, AC108866.5 contains 193bp more data than AC116647.4, join supported by fosmid end pair, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC112227	AC125245		other	polymorphic based on genomic pcr assay	SINE/Alu, LINE/L1. AC112227.4 contains 639bp and 81bp more than AC125245.4, join supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]
AC112713	AC125333		other	in progress	2217 bp overlap, AC112713.3 contains 122bp more data than AC125333.4	return	requires BAC, fosmid end support or other	[email protected]
AC007249	AC007314	AC007314			no overlap was finished, but sequence from a previous accession version confirms overlap	pass		[email protected]
AC009411	AC018742	AC084349			another accession sequenced to confirm join	pass		[email protected]
AC012065	AC012361	AC023124			another accession sequenced to confirm join	pass		[email protected]
AC012003	AC012353	AC034171			another accession finished to confirm join	pass		[email protected]
AC092594	AC130814		other	polymorphic, based on pcr assay	AC130814.3 contains two copies of a 19kb region and AC092594.2 only contains one copy , we have assayed this overlap and found it to be polymorphic	pass	in future, helpful to include BAC or fosmid end sequence evidence in these cases.	[email protected]
AC068279	AC133644		other		not able to pcr due to repetative nature of clone	unresolved	Assuming that no further work is possible; there is BAC and fosmid end support.	[email protected]
AC130223	AC134873		other	in progress	We believe that AC130223 (telomeric cosmid from Harold Riethman) is deleted, but it extends out further towards the telomere, so we want to use a portion of the sequence. It will probably be clipped back.	in process	Please return certificate when resolved.	[email protected]
AC095038	AC118758		sine	repeatmasker	Alu. indel present, 2766bp overlap between AC095038.3 and AC118758.3, AC095038.3 contains 129bp more data than AC118758.3, join is supported by both fosmid and bac end pairs	pass	InDel should probably be confirmed	[email protected]
AC018696	AC116050		other	repeatmasker	SINE/Alu, Satellite, LTR/ERVL, LINE/L1, SINE/MIR, LTR/MaLR, LINE/L2. centromeric, multiple indels contained in overlap, entire overlap is 74kb, many fosmid and BAC links	return	clear overrepresentation of bac- and fosmid-ends. Investigate. requires additional support eg. PCR	[email protected]
AC010984	AC133785		other	polymorphic based on genomic pcr assay	LINE/L2, LTR/MaLR, SINE/MIR, SINE/Alu, LINE/L1. AC133785.2 contains 8243bp more data than AC010984.7, join is also supported by bac and fosmid end pairs, bp differences in the overlap were assayed and the overlap was found to be polymorphic	pass		[email protected]